pEN527 - Rad21-AID[71-114]-eGFP-FRT-Blast-FRT targeting construct
(Plasmid
#156452)
-
PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse RAD21 (SCC1) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA CCACGGTTCCATATTATCTG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 156452 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEN527 - Rad21-AID[71-114]-eGFP-FRT-Blast-FRT targeting construct
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAD21, AID
-
Alt nameSCC1
-
SpeciesM. musculus (mouse)
-
Mutationnone
-
Entrez GeneRad21 (a.k.a. SCC, SCC1, mHR21, mKIAA0078)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN527 - Rad21-AID[71-114]-eGFP-FRT-Blast-FRT targeting construct was a gift from Elphege Nora (Addgene plasmid # 156452 ; http://n2t.net/addgene:156452 ; RRID:Addgene_156452) -
For your References section:
WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation. Liu NQ, Maresca M, van den Brand T, Braccioli L, Schijns MMGA, Teunissen H, Bruneau BG, Nora EP, de Wit E. Nat Genet. 2021 Jan;53(1):100-109. doi: 10.1038/s41588-020-00744-4. Epub 2020 Dec 14. 10.1038/s41588-020-00744-4 PubMed 33318687