T7 promoter + filler DNA reporter plasmid
(Plasmid
#156454)
-
PurposeA mutational reporter plasmid that can gain Kanamycin and/or Tetracycline resistance upon mutation. Contains T7 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 156454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneBAC
- Backbone size w/o insert (bp) 5863
- Total vector size (bp) 10023
-
Modifications to backboneChloramphenicol resistance marker replaced with ampicillin resistance marker.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameNeoR/KanR
-
SpeciesTn5
-
Insert Size (bp)801
-
MutationATG start codon mutated to ACG
- Promoter Em7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer GTGCACCCAACTGATCTTCA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTcR
-
Alt nameTetA
-
SpeciesTn10
-
Insert Size (bp)1203
-
MutationATG start codon mutated to ACG
- Promoter tet
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BclI (destroyed during cloning)
- 5′ sequencing primer actggcatgataaggccaatcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypcDNA3.1 and psc101
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that a low DNA yield is expected with single copy BACs. Using larger scale DNA preps (ie. midi preps) is recommended. If there are difficulties removing genomic DNA, the ExonucleaseV (recBCD) from NEB (M0345S) which degrades contaminating linear DNA can help improve results.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7 promoter + filler DNA reporter plasmid was a gift from Matthew D. Shoulders (Addgene plasmid # 156454 ; http://n2t.net/addgene:156454 ; RRID:Addgene_156454) -
For your References section:
A Processive Protein Chimera Introduces Mutations across Defined DNA Regions In Vivo. Moore CL, Papa LJ 3rd, Shoulders MD. J Am Chem Soc. 2018 Sep 19;140(37):11560-11564. doi: 10.1021/jacs.8b04001. Epub 2018 Jul 18. 10.1021/jacs.8b04001 PubMed 29991261