Skip to main content

T7 promoter + rpsL reporter plasmid
(Plasmid #156455)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 156455 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    BAC
  • Backbone size w/o insert (bp) 4732
  • Total vector size (bp) 8401
  • Modifications to backbone
    Chloramphenicol resistance marker replaced with ampicillin resistance marker.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    rpsL
  • Species
    Escherichia coli
  • Insert Size (bp)
    375
  • Promoter tac

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer GTGCACCCAACTGATCTTCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TcR
  • Alt name
    TetA
  • Species
    Tn10
  • Insert Size (bp)
    1203
  • Mutation
    ATG start codon mutated to ACG
  • Promoter tet

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BclI (destroyed during cloning)
  • 5′ sequencing primer actggcatgataaggccaatcc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    psc101

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that a low DNA yield is expected with single copy BACs. Using larger scale DNA preps (ie. midi preps) is recommended. If there are difficulties removing genomic DNA, the ExonucleaseV (recBCD) from NEB (M0345S) which degrades contaminating linear DNA can help improve results.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    T7 promoter + rpsL reporter plasmid was a gift from Matthew D. Shoulders (Addgene plasmid # 156455 ; http://n2t.net/addgene:156455 ; RRID:Addgene_156455)
  • For your References section:

    A Processive Protein Chimera Introduces Mutations across Defined DNA Regions In Vivo. Moore CL, Papa LJ 3rd, Shoulders MD. J Am Chem Soc. 2018 Sep 19;140(37):11560-11564. doi: 10.1021/jacs.8b04001. Epub 2018 Jul 18. 10.1021/jacs.8b04001 PubMed 29991261