-
PurposeExpresses a rabbit Fc-ICAM1 fusion protein in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 156462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUSE
-
Backbone manufacturerInvivogen
- Backbone size w/o insert (bp) 4179
- Total vector size (bp) 5539
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIntercellular Adhesion Molecule 1
-
Alt nameICAM1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1387
-
Mutationendogenous signal peptide replaced with IL2 signal sequence; membrane domain replaced with rabbit IgG Fc, P66S and L234P in ICAM (based on open reading frame) - please see depositor comments
-
Entrez GeneIcam1 (a.k.a. CD54, Icam-1, Ly-47, MALA-2)
- Promoter hEF1-HTLC
-
Tag
/ Fusion Protein
- ICAM1-rFc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer tgtcacgaattcgcaggtatccatccatcccagagaag
- 3′ sequencing primer atgcagatctgttattttgagagtggtacagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Depositor confirms P66S and L234P mutations does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUSE-rIgG-Fc2-ICAM1 was a gift from Dirk Mielenz (Addgene plasmid # 156462 ; http://n2t.net/addgene:156462 ; RRID:Addgene_156462) -
For your References section:
B Cell Speed and B-FDC Contacts in Germinal Centers Determine Plasma Cell Output via Swiprosin-1/EFhd2. Reimer D, Meyer-Hermann M, Rakhymzhan A, Steinmetz T, Tripal P, Thomas J, Boettcher M, Mougiakakos D, Schulz SR, Urbanczyk S, Hauser AE, Niesner RA, Mielenz D. Cell Rep. 2020 Aug 11;32(6):108030. doi: 10.1016/j.celrep.2020.108030. 10.1016/j.celrep.2020.108030 PubMed 32783949