pD649-HAsp-GAS6-Fc(DAPA)-AviTag-6xHis
(Plasmid
#156947)
-
PurposeMammalian expression of secreted protein fused to Fc(DAPA)-Avi-6xHis.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 156947 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepD649
- Backbone size w/o insert (bp) 6106
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAS6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2073
-
MutationFc region of human IgG contains D265A and P329A mutations (DAPA)
-
Entrez GeneGAS6 (a.k.a. AXLLG, AXSF)
- Promoter CMV/SP6
-
Tag
/ Fusion Protein
- Fc(DAPA)-AviTag-6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site GCGGCCGC (not destroyed)
- 3′ cloning site GGCGCGCC (not destroyed)
- 5′ sequencing primer ATTTAGGTGACACTATAG
- 3′ sequencing primer CACGTACCAGTTGAACTTCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bysynthesis by ThermoFisher
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD649-HAsp-GAS6-Fc(DAPA)-AviTag-6xHis was a gift from Chris Garcia (Addgene plasmid # 156947 ; http://n2t.net/addgene:156947 ; RRID:Addgene_156947) -
For your References section:
A Human IgSF Cell-Surface Interactome Reveals a Complex Network of Protein-Protein Interactions. Wojtowicz WM, Vielmetter J, Fernandes RA, Siepe DH, Eastman CL, Chisholm GB, Cox S, Klock H, Anderson PW, Rue SM, Miller JJ, Glaser SM, Bragstad ML, Vance J, Lam AW, Lesley SA, Zinn K, Garcia KC. Cell. 2020 Aug 20;182(4):1027-1043.e17. doi: 10.1016/j.cell.2020.07.025. 10.1016/j.cell.2020.07.025 PubMed 32822567