pET28a-ybbR-His-ELP(MV7E2)3-ddFLN4-SpyCatcher
(Plasmid
#157674)
-
PurposeExpression of SpyCatcher with ddFLN4, ELP linker, His6x tag, and ybbR Tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157674 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5220
- Total vector size (bp) 6470
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyCatcher with ddFLN4, ELP, Histag and ybbR tag
-
Insert Size (bp)1251
- Promoter T7
-
Tag
/ Fusion Protein
- ddFLN4, ELP, Histag and ybbR tag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTAGCGTTGATACCCTGAGC
- 3′ sequencing primer CTTTGTTAGCAGCCGGATCCTTAGATGTGGGCATCACCTTTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-ybbR-His-ELP(MV7E2)3-ddFLN4-SpyCatcher was a gift from Michael Nash (Addgene plasmid # 157674 ; http://n2t.net/addgene:157674 ; RRID:Addgene_157674) -
For your References section:
Influence of Fluorination on Single-Molecule Unfolding and Rupture Pathways of a Mechanostable Protein Adhesion Complex. Yang B, Liu H, Liu Z, Doenen R, Nash MA. Nano Lett. 2020 Nov 16. doi: 10.1021/acs.nanolett.0c04178. 10.1021/acs.nanolett.0c04178 PubMed 33191756