pQE80L-His-SpyTag-XMod-Doc(WT)
(Plasmid
#157675)
-
PurposeExpression of XMod-Doc wild type with His6x tag and SpyTag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157675 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQE80l
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 5513
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXMod-Doc Wild type with Histag and SpyTag
-
Insert Size (bp)993
- Promoter T5
-
Tag
/ Fusion Protein
- Histag and SpyTag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGAAGCTCGACGGCCACAATACCGTTACCAGCGCAGTT
- 3′ sequencing primer TGTTAGCAGCCGGATCCTTATTCTTCTTCCGCATCACCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE80L-His-SpyTag-XMod-Doc(WT) was a gift from Michael Nash (Addgene plasmid # 157675 ; http://n2t.net/addgene:157675 ; RRID:Addgene_157675) -
For your References section:
Influence of Fluorination on Single-Molecule Unfolding and Rupture Pathways of a Mechanostable Protein Adhesion Complex. Yang B, Liu H, Liu Z, Doenen R, Nash MA. Nano Lett. 2020 Nov 16. doi: 10.1021/acs.nanolett.0c04178. 10.1021/acs.nanolett.0c04178 PubMed 33191756