Plasmid EUPp_09
(Plasmid
#157745)
-
PurposePgyrA_ada _adh2 _pMB1_ampR (for expressing two enzymes (Ada and Adh2) to allow E. coli to consume ethanol)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePgyrA_pMB1_ampR
- Backbone size w/o insert (bp) 2502
- Total vector size (bp) 4952
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameacetaldehyde dehydrogenase
-
Alt nameada
-
SpeciesDickeya zeae
-
Insert Size (bp)1374
- Promoter PgyrA
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ggaacactccgtgatcgaacc
- 3′ sequencing primer Aggcaatacggaacatatcc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namealcohol dehydrogenase
-
Alt nameadh2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1041
-
GenBank ID
-
Entrez GeneADH2 (a.k.a. YMR303C, ADR2)
- Promoter PgyrA
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer Gtctattccagaaactcaaaa
- 3′ sequencing primer Atttagaagtgtcaacaacg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Plasmid EUPp_09 was a gift from Kang Zhou (Addgene plasmid # 157745 ; http://n2t.net/addgene:157745 ; RRID:Addgene_157745) -
For your References section:
Constructing an ethanol utilization pathway in Escherichia coli to produce acetyl-CoA derived compounds. Liang H, Ma X, Ning W, Liu Y, Sinskey AJ, Stephanopoulos G, Zhou K. Metab Eng. 2020 Nov 25. pii: S1096-7176(20)30180-4. doi: 10.1016/j.ymben.2020.11.010. 10.1016/j.ymben.2020.11.010 PubMed 33248272