pWM_12x601_30bpLinker
(Plasmid
#157789)
-
PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 30 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepWM
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name12x601_30bp linker
-
SpeciesSynthetic
-
Insert Size (bp)2142
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI/HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AGCCCGCTCATTAGGCGGGCTAC
- 3′ sequencing primer AGCGGATAACAATTTCACACAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
occasional plasmid instability in dam-/dcm- strains
High copy plasmid (pUC-based, but medium yield)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWM_12x601_30bpLinker was a gift from Michael Rosen (Addgene plasmid # 157789 ; http://n2t.net/addgene:157789 ; RRID:Addgene_157789) -
For your References section:
Organization of Chromatin by Intrinsic and Regulated Phase Separation. Gibson BA, Doolittle LK, Schneider MWG, Jensen LE, Gamarra N, Henry L, Gerlich DW, Redding S, Rosen MK. Cell. 2019 Oct 3;179(2):470-484.e21. doi: 10.1016/j.cell.2019.08.037. Epub 2019 Sep 19. 10.1016/j.cell.2019.08.037 PubMed 31543265