pDendra2-H2a
(Plasmid
#157816)
-
PurposeFluorescent reporter for histone H2A tracking
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157816 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneDendra2-N1
- Backbone size w/o insert (bp) 4750
- Total vector size (bp) 5099
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2A
-
Alt nameHist1h2ai
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)390
-
GenBank ID319191
-
Entrez GeneH2ac13 (a.k.a. H2a-291A, Hist1h2ai)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer N/A
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDendra2-H2a was a gift from Xin Chen (Addgene plasmid # 157816 ; http://n2t.net/addgene:157816 ; RRID:Addgene_157816) -
For your References section:
Differential Histone Distribution Patterns in Induced Asymmetrically Dividing Mouse Embryonic Stem Cells. Ma B, Trieu TJ, Cheng J, Zhou S, Tang Q, Xie J, Liu JL, Zhao K, Habib SJ, Chen X. Cell Rep. 2020 Aug 11;32(6):108003. doi: 10.1016/j.celrep.2020.108003. 10.1016/j.celrep.2020.108003 PubMed 32783931