Skip to main content

61427-sgHtt_6
(Plasmid #157860)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157860 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene #61427
  • Backbone size w/o insert (bp) 9996
  • Total vector size (bp) 9997
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Htt
  • gRNA/shRNA sequence
    TCGTCCTCTTTCCCGAAGTC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Htt (a.k.a. C430023I11Rik, Hd, Hdh, IT15)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    61427-sgHtt_6 was a gift from Xinyu Zhao (Addgene plasmid # 157860 ; http://n2t.net/addgene:157860 ; RRID:Addgene_157860)
  • For your References section:

    Reduced mitochondrial fusion and Huntingtin levels contribute to impaired dendritic maturation and behavioral deficits in Fmr1-mutant mice. Shen M, Wang F, Li M, Sah N, Stockton ME, Tidei JJ, Gao Y, Korabelnikov T, Kannan S, Vevea JD, Chapman ER, Bhattacharyya A, van Praag H, Zhao X. Nat Neurosci. 2019 Mar;22(3):386-400. doi: 10.1038/s41593-019-0338-y. Epub 2019 Feb 11. 10.1038/s41593-019-0338-y PubMed 30742117