pJDC124
(Plasmid
#157877)
-
PurposemCherry is expressed under the mycobacterial phsp60 heat shock promoter for in vivo and in vitro detection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157877 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJDC89
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry
- Promoter phsp60
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site ScaI (unknown if destroyed)
- 5′ sequencing primer AGGAGGATAACATATGGAAGATGC
- 3′ sequencing primer CAGCTTCGACTTGCCTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Rodger Y. Tsien
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJDC124 was a gift from Jeffrey Cirillo (Addgene plasmid # 157877 ; http://n2t.net/addgene:157877 ; RRID:Addgene_157877) -
For your References section:
Application of Fluorescent Protein Expressing Strains to Evaluation of Anti-Tuberculosis Therapeutic Efficacy In Vitro and In Vivo. Kong Y, Yang D, Cirillo SL, Li S, Akin A, Francis KP, Maloney T, Cirillo JD. PLoS One. 2016 Mar 2;11(3):e0149972. doi: 10.1371/journal.pone.0149972. eCollection 2016. 10.1371/journal.pone.0149972 PubMed 26934495