Skip to main content

Lenti AID-BEmax
(Plasmid #157950)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157950 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Adapted from lentiCRISPRv1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lenti AID-BEmax
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctgcagacaaatggcagta
  • 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti AID-BEmax was a gift from Dali Li (Addgene plasmid # 157950 ; http://n2t.net/addgene:157950 ; RRID:Addgene_157950)
  • For your References section:

    Dual base editor catalyzes both cytosine and adenine base conversions in human cells. Zhang X, Zhu B, Chen L, Xie L, Yu W, Wang Y, Li L, Yin S, Yang L, Hu H, Han H, Li Y, Wang L, Chen G, Ma X, Geng H, Huang W, Pang X, Yang Z, Wu Y, Siwko S, Kurita R, Nakamura Y, Yang L, Liu M, Li D. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0527-y. doi: 10.1038/s41587-020-0527-y. 10.1038/s41587-020-0527-y PubMed 32483363