Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
(Plasmid
#157951)
-
PurposeLentiviral expression of HBG site 1 sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAdapted from lentiCRISPRv2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgcagacaaatggcagta
- 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP was a gift from Dali Li (Addgene plasmid # 157951 ; http://n2t.net/addgene:157951 ; RRID:Addgene_157951) -
For your References section:
Dual base editor catalyzes both cytosine and adenine base conversions in human cells. Zhang X, Zhu B, Chen L, Xie L, Yu W, Wang Y, Li L, Yin S, Yang L, Hu H, Han H, Li Y, Wang L, Chen G, Ma X, Geng H, Huang W, Pang X, Yang Z, Wu Y, Siwko S, Kurita R, Nakamura Y, Yang L, Liu M, Li D. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0527-y. doi: 10.1038/s41587-020-0527-y. 10.1038/s41587-020-0527-y PubMed 32483363