Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #157996)


Item Catalog # Description Quantity Price (USD)
Plasmid 157996 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6105
  • Total vector size (bp) 6825
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
  • Insert Size (bp)
  • Mutation
    mGold is mVenus with L46F;T63S mutations
  • Promoter Actin promoter with CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer aaggtggtggctggtgtggc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Please note that the mVenus annotation in the plasmid map is incorrect, as this plasmid encodes mGold.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCaggs-mGold was a gift from Francois St-Pierre (Addgene plasmid # 157996 ; ; RRID:Addgene_157996)
  • For your References section:

    Versatile phenotype-activated cell sorting. Lee J, Liu Z, Suzuki PH, Ahrens JF, Lai S, Lu X, Guan S, St-Pierre F. Sci Adv. 2020 Oct 23;6(43). pii: 6/43/eabb7438. doi: 10.1126/sciadv.abb7438. Print 2020 Oct. 10.1126/sciadv.abb7438 PubMed 33097540