pJL2-mGold-P2A-EBFP2
(Plasmid
#157998)
-
PurposeCo-expression of mGold and EBFP2 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 157998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJL2
- Backbone size w/o insert (bp) 6992
- Total vector size (bp) 8507
-
Vector typeMammalian Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemGold-P2A-EBFP2
-
SpeciesSynthetic
-
Insert Size (bp)1515
-
MutationmGold is mVenus with L46F;T63S mutations
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A mammalian expression cassette was cloned into a yeast vector.
mGold: FPBaseID TBD
EBFP2: FPBaseID DVMQ7 Please note that the mVenus annotation in the plasmid map is incorrect, as this plasmid encodes mGold.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL2-mGold-P2A-EBFP2 was a gift from Francois St-Pierre (Addgene plasmid # 157998 ; http://n2t.net/addgene:157998 ; RRID:Addgene_157998) -
For your References section:
Versatile phenotype-activated cell sorting. Lee J, Liu Z, Suzuki PH, Ahrens JF, Lai S, Lu X, Guan S, St-Pierre F. Sci Adv. 2020 Oct 23;6(43). pii: 6/43/eabb7438. doi: 10.1126/sciadv.abb7438. Print 2020 Oct. 10.1126/sciadv.abb7438 PubMed 33097540