Skip to main content
Addgene

pDOC-K-glmS-GFPrev
(Plasmid #158060)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158060 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDOC-K-glmS
  • Backbone manufacturer
    Addgene #158058
  • Backbone size w/o insert (bp) 8079
  • Total vector size (bp) 8894
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Green Fluorescent Protein optimised for excitation with UV light
  • Alt name
    GFPuv
  • Species
    Synthetic; Aequorea victoria
  • Insert Size (bp)
    717
  • Promoter acpP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer GTTGCAAATTTTTCAACATTT
  • 3′ sequencing primer TTATTTGTAGAGCTCATCCATG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Amplified from pZEP08 in Hautefort, I., Proença, M. J., and Hinton, J. C. (2003) Single-copy green fluorescent protein gene fusions allow accurate measurement of Salmonella gene expression in vitro and during infection of mammalian cells, Appl. Environ. Microbiol. 69, 7480-7491

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDOC-K-glmS-GFPrev was a gift from Mark Webber (Addgene plasmid # 158060 ; http://n2t.net/addgene:158060 ; RRID:Addgene_158060)
  • For your References section:

    Donor plasmids for phenotypically neutral chromosomal gene insertions in Enterobacteriaceae. Holden ER, Wickham GJ, Webber MA, Thomson NM, Trampari E. Microbiology (Reading). 2020 Nov 23. doi: 10.1099/mic.0.000994. 10.1099/mic.0.000994 PubMed 33226934