-
PurposeExpressing evolved CasTA of dCas9 fused AsiA variant 2.1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepdCas9-bacteria
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 7000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCas9-AsiA_m2.1
-
SpeciesSynthetic
-
Insert Size (bp)4413
- Promoter TetO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCTCATTAAGCAGCTCTAATGCGCTG
- 3′ sequencing primer TGTGACTCTAGTAGAGAGCGTTCAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdCas9- AsiA_m2.1 was a gift from Harris Wang (Addgene plasmid # 158065 ; http://n2t.net/addgene:158065 ; RRID:Addgene_158065) -
For your References section:
Programmable CRISPR-Cas transcriptional activation in bacteria. Ho HI, Fang JR, Cheung J, Wang HH. Mol Syst Biol. 2020 Jul;16(7):e9427. doi: 10.15252/msb.20199427. 10.15252/msb.20199427 PubMed 32657546