pTRE3G-EGFPC-uL10-(Neo)R
(Plasmid
#158069)
-
PurposeeGFP and uL10 ribosomal protein under the TRE3G promoter, Neo resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRE3G-IRES
-
Backbone manufacturerClontech Laboratories, Inc. A Takara Bio Compa
- Backbone size w/o insert (bp) 4026
- Total vector size (bp) 6487
-
Modifications to backbone1. Insertion of sequence encoding human ribosomal protein uL10 with N-terminal fusion of EGFP 2.Replacement of Amp resistance cassette with Neo/Kan resistance cassette
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRPLP0
-
Alt nameuL10, P0; LP0; L10E; RPP0; PRLP0
-
SpeciesH. sapiens (human)
-
Insert Size (bp)984
-
GenBank ID6175
-
Entrez GeneRPLP0 (a.k.a. L10E, LP0, P0, PRLP0, RPP0, uL10)
- Promoter TRE3G
-
Tag
/ Fusion Protein
- eGFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAGAGCTCGTTTAGTGAACC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE3G-EGFPC-uL10-(Neo)R was a gift from Adolfo Rivero-Muller (Addgene plasmid # 158069 ; http://n2t.net/addgene:158069 ; RRID:Addgene_158069) -
For your References section:
An Improved Vector System for Homogeneous and Stable Gene Regulation. Michalec-Wawiorka B, Czapinski J, Filipek K, Rulak P, Czerwonka A, Tchorzewski M, Rivero-Muller A. Int J Mol Sci. 2021 May 14;22(10). pii: ijms22105206. doi: 10.3390/ijms22105206. 10.3390/ijms22105206 PubMed 34069024