Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCTCON2-GFP
(Plasmid #158130)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158130 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCTCON2
  • Backbone size w/o insert (bp) 6314
  • Total vector size (bp) 6455
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sfGFP
  • Insert Size (bp)
    720
  • Promoter GAL1-10

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGCATAACCACTTTAACTAATACTTTC
  • 3′ sequencing primer GTAAAGTTGGTAACGGAACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The GFP gene was originally amplified from pRYG, obtained from the laboratory of Jeffrey Barrick at The University of Texas Austin (Addgene plasmid #113642)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCTCON2-GFP was a gift from James Van Deventer (Addgene plasmid # 158130 ; http://n2t.net/addgene:158130 ; RRID:Addgene_158130)
  • For your References section:

    Reporter system architecture affects measurements of noncanonical amino acid incorporation efficiency and fidelity. Potts KA, Stieglitz JT, Lei M, Van Deventer JA. Mol Syst Des Eng. 2020 Feb 1;5(2):573-588. doi: 10.1039/c9me00107g. Epub 2020 Jan 23. 10.1039/c9me00107g PubMed 33791108