pSBBi-Pur LaG17-synNotch-TetRVP64
(Plasmid
#158133)
-
PurposeConstitutive expression of anti-GFP nanobody (LaG-17) synNotch TetRVP64 receptor in a pSBBi-Pur Sleeping Beauty backbone
-
Depositing Lab
-
Publication
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBBi-Pur
- Total vector size (bp) 7903
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLaG17-synNotch-TetRVP64
-
Alt nameanti-GFP synNotch TetRVP64
-
SpeciesSynthetic
-
Insert Size (bp)2223
- Promoter EF1α
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWendell Lim lab Morsut et al Cell. 2016 Feb 11;164(4):780-91. doi: 10.1016/j.cell.2016.01.012. Epub 2016 Jan 28.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SB-transposon with constitutive bi-directional promoter. One side contains anti-GFP LaG17-synNotch-Gal4VP64; the other side contains puromycin resistance .
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBBi-Pur LaG17-synNotch-TetRVP64 was a gift from Neal Devaraj (Addgene plasmid # 158133 ; http://n2t.net/addgene:158133 ; RRID:Addgene_158133)