Skip to main content

pSBBi-Pur LaG17-synNotch-TetRVP64
(Plasmid #158133)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158133 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBBi-Pur
  • Total vector size (bp) 7903
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LaG17-synNotch-TetRVP64
  • Alt name
    anti-GFP synNotch TetRVP64
  • Species
    Synthetic
  • Insert Size (bp)
    2223
  • Promoter EF1α

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Wendell Lim lab Morsut et al Cell. 2016 Feb 11;164(4):780-91. doi: 10.1016/j.cell.2016.01.012. Epub 2016 Jan 28.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SB-transposon with constitutive bi-directional promoter. One side contains anti-GFP LaG17-synNotch-Gal4VP64; the other side contains puromycin resistance .

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBBi-Pur LaG17-synNotch-TetRVP64 was a gift from Neal Devaraj (Addgene plasmid # 158133 ; http://n2t.net/addgene:158133 ; RRID:Addgene_158133)