Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #158419)


Item Catalog # Description Quantity Price (USD)
Plasmid 158419 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Elizabeth Simpson (Addgene plasmid # 111895)
  • Backbone size w/o insert (bp) 4999
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    SURE cells
  • Growth instructions
    “SURE” cells from Agilent, that the colonies are freshly picked, and the you limit the time to grow the culture. We typically transform the plasmid in the afternoon and take out the plate from the 37 degree incubator in the morning, we then pick the colonies and grow in LB for ~ 20 hrs
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    PDE6H MiniPromoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    PDE6H (a.k.a. ACHM6, RCD3)
  • Promoter Ple349

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer oEMS6098 (GCCATGCTCTAGGAAGATCG)
  • 3′ sequencing primer oEMS6163 (GGTTCTTGATCCCTTCTGAC)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please see the annotated GenBank file and the additional image file for the specific location of features in this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEMS2284 was a gift from Elizabeth Simpson (Addgene plasmid # 158419 ; ; RRID:Addgene_158419)
  • For your References section:

    Human MiniPromoters for ocular-rAAV expression in ON bipolar, cone, corneal, endothelial, Muller glial, and PAX6 cells. Korecki AJ, Cueva-Vargas JL, Fornes O, Agostinone J, Farkas RA, Hickmott JW, Lam SL, Mathelier A, Zhou M, Wasserman WW, Di Polo A, Simpson EM. Gene Ther. 2021 Feb 2. pii: 10.1038/s41434-021-00227-z. doi: 10.1038/s41434-021-00227-z. 10.1038/s41434-021-00227-z PubMed 33531684