PB-CuO-V5-CASC3 siRes 110-480 188/218-mut
(Plasmid
#158544)
-
PurposeFor PiggyBac-mediated integration of V5-tagged siRNA-resistant EJC-binding deficient CASC3 110-480
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePB-Cuo-MCS-IRES-GFP-EF1α-CymR-Puro
-
Backbone manufacturerSBI
- Backbone size w/o insert (bp) 9509
- Total vector size (bp) 10659
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCASC3; BTZ; MLN51
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1113
-
MutationAmino acids 110-480, C-terminal deletion, F188D, W218D
-
Entrez GeneCASC3 (a.k.a. BTZ, MLN51)
- Promoter CMV
-
Tag
/ Fusion Protein
- V5 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe (not destroyed)
- 3′ cloning site Not (not destroyed)
- 5′ sequencing primer CCGATCTGGCCATACACTTG
- 3′ sequencing primer GCCCTCACATTGCCAAAAGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-CuO-V5-CASC3 siRes 110-480 188/218-mut was a gift from Niels Gehring (Addgene plasmid # 158544 ; http://n2t.net/addgene:158544 ; RRID:Addgene_158544) -
For your References section:
CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complex. Gerbracht JV, Boehm V, Britto-Borges T, Kallabis S, Wiederstein JL, Ciriello S, Aschemeier DU, Kruger M, Frese CK, Altmuller J, Dieterich C, Gehring NH. Nucleic Acids Res. 2020 Jul 4. pii: 5867419. doi: 10.1093/nar/gkaa564. 10.1093/nar/gkaa564 PubMed 32621609