Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pXPR_502_sgCD4
(Plasmid #158704)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158704 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD4
  • gRNA/shRNA sequence
    ATGTTCCCTGAGAGCCTGGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For questions regarding use of this plasmid, please contact John Doench.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_502_sgCD4 was a gift from John Doench & David Root (Addgene plasmid # 158704 ; http://n2t.net/addgene:158704 ; RRID:Addgene_158704)
  • For your References section:

    Identification of Antinorovirus Genes in Human Cells Using Genome-Wide CRISPR Activation Screening. Orchard RC, Sullender ME, Dunlap BF, Balce DR, Doench JG, Virgin HW. J Virol. 2018 Dec 10;93(1). pii: JVI.01324-18. doi: 10.1128/JVI.01324-18. Print 2019 Jan 1. 10.1128/JVI.01324-18 PubMed 30305350