-
PurposeMammalian expression vector for expressing SARS-2 Spike with 21 aa del at C-terminus and pt mutation D to G at site 614
-
Depositing Lab
-
Depositing OrganizationFred Hutchinson Cancer Center
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 158762-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 158762-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneHDM
- Backbone size w/o insert (bp) 4552
- Total vector size (bp) 8314
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS2-Spike_del21_D614G
-
Alt nameSpike
-
SpeciesSynthetic; Severe acute respiratory syndrome coronavirus 2
-
Insert Size (bp)3672
-
Mutationdeleted amino acids 1257-1278, changed aspartic acid at position 614 to glycine
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer ggcccttttgctaatcatgttcatacctcttatct
- 3′ sequencing primer ttaaatgcactgacctcccacattc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 158762-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 158762-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HDM_SARS2_Spike_del21_D614G was a gift from Jesse Bloom (Addgene plasmid # 158762 ; http://n2t.net/addgene:158762 ; RRID:Addgene_158762) -
For your References section:
Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays. Crawford KHD, Eguia R, Dingens AS, Loes AN, Malone KD, Wolf CR, Chu HY, Tortorici MA, Veesler D, Murphy M, Pettie D, King NP, Balazs AB, Bloom JD. Viruses. 2020 May 6;12(5). pii: v12050513. doi: 10.3390/v12050513. 10.3390/v12050513 PubMed 32384820
Map uploaded by the depositor.
