PET.SUMO eIF4G1 1-200
(Plasmid
#158791)
-
PurposeBacterial expression vector for the expression of N-terminal 6xHIS-SUMO-tagged codon optimized eIF4G1 amino acids 1-200 isoform lacking the microexon.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158791 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET SUMO
-
Backbone manufacturerInvitrogen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeIF4G1 (codon optimized)
-
SpeciesH. sapiens (human)
-
Mutationamino acids 1-200
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHIS (N terminal on backbone)
- SUMO (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AGATTCTTGTACGACGGTATTAG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PET.SUMO eIF4G1 1-200 was a gift from Benjamin Blencowe (Addgene plasmid # 158791 ; http://n2t.net/addgene:158791 ; RRID:Addgene_158791) -
For your References section:
Autism-Misregulated eIF4G Microexons Control Synaptic Translation and Higher Order Cognitive Functions. Gonatopoulos-Pournatzis T, Niibori R, Salter EW, Weatheritt RJ, Tsang B, Farhangmehr S, Liang X, Braunschweig U, Roth J, Zhang S, Henderson T, Sharma E, Quesnel-Vallieres M, Permanyer J, Maier S, Georgiou J, Irimia M, Sonenberg N, Forman-Kay JD, Gingras AC, Collingridge GL, Woodin MA, Cordes SP, Blencowe BJ. Mol Cell. 2020 Mar 19;77(6):1176-1192.e16. doi: 10.1016/j.molcel.2020.01.006. Epub 2020 Jan 29. 10.1016/j.molcel.2020.01.006 PubMed 31999954