Skip to main content

pX330-gRNA
(Plasmid #158973)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158973 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Total vector size (bp) 8509
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA3
  • Alt name
    pX330-gRNA
  • Species
    Synthetic
  • Insert Size (bp)
    21
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs-I (destroyed during cloning)
  • 3′ cloning site Bbs-I (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The plasmid was generated from Addgene Plasmid #42230 by cloning gRNA3 into the pX330 backbone.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-gRNA was a gift from Charles P. Lai (Addgene plasmid # 158973 ; http://n2t.net/addgene:158973 ; RRID:Addgene_158973)
  • For your References section:

    A multiplexed bioluminescent reporter for sensitive and non-invasive tracking of DNA double strand break repair dynamics in vitro and in vivo. Chien JC, Tabet E, Pinkham K, da Hora CC, Chang JC, Lin S, Badr CE, Lai CP. Nucleic Acids Res. 2020 Aug 14. pii: 5892751. doi: 10.1093/nar/gkaa669. 10.1093/nar/gkaa669 PubMed 32797168