Skip to main content

LDB-14-p65
(Plasmid #158985)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158985 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 158985-D50 50 μg of DNA in Tris buffer $495
DNA 158985-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5438
  • Total vector size (bp) 6820
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LDB-14-p65
  • Species
    Synthetic
  • Insert Size (bp)
    1382
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 tag , 6xHis tag (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAACTAGAGAACCCACTGCTTA
  • 3′ sequencing primer ACA GTC GAG GCT GAT CAG CGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LDB-14-p65 was a gift from Liangcai Gu (Addgene plasmid # 158985 ; http://n2t.net/addgene:158985 ; RRID:Addgene_158985)
  • For your References section:

    Creating Red Light-Switchable Protein Dimerization Systems as Genetically Encoded Actuators with High Specificity. Huang Z, Li Z, Zhang X, Kang S, Dong R, Sun L, Fu X, Vaisar D, Watanabe K, Gu L. ACS Synth Biol. 2020 Nov 12. doi: 10.1021/acssynbio.0c00397. 10.1021/acssynbio.0c00397 PubMed 33179507