LDB-14-p65
(Plasmid
#158985)
-
PurposeExpresses LDB-14 fused with a C-terminal p65 transcriptional activation domain in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158985 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5438
- Total vector size (bp) 6820
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLDB-14-p65
-
SpeciesSynthetic
-
Insert Size (bp)1382
- Promoter CMV
-
Tag
/ Fusion Protein
- V5 tag , 6xHis tag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAACTAGAGAACCCACTGCTTA
- 3′ sequencing primer ACA GTC GAG GCT GAT CAG CGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LDB-14-p65 was a gift from Liangcai Gu (Addgene plasmid # 158985 ; http://n2t.net/addgene:158985 ; RRID:Addgene_158985) -
For your References section:
Creating Red Light-Switchable Protein Dimerization Systems as Genetically Encoded Actuators with High Specificity. Huang Z, Li Z, Zhang X, Kang S, Dong R, Sun L, Fu X, Vaisar D, Watanabe K, Gu L. ACS Synth Biol. 2020 Nov 12. doi: 10.1021/acssynbio.0c00397. 10.1021/acssynbio.0c00397 PubMed 33179507