Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #158990)


Item Catalog # Description Quantity Price (USD)
Plasmid 158990 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pX601 (Addgene #61591)
  • Total vector size (bp) 7250
  • Modifications to backbone
    replace bGHpA with spA; replaced SaCas9 with dSaCas9-VP64
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter pCMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GCAGGTTGTAGTCGAACAGCAGCT
  • 3′ sequencing primer CAGCACAGACATTCTGGGCAACCT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA was a gift from Chung Tin (Addgene plasmid # 158990 ; ; RRID:Addgene_158990)
  • For your References section:

    Targeted Transgene Activation in the Brain Tissue by Systemic Delivery of Engineered AAV1 Expressing CRISPRa. Lau CH, Ho JW, Lo PK, Tin C. Mol Ther Nucleic Acids. 2019 Jun 7;16:637-649. doi: 10.1016/j.omtn.2019.04.015. Epub 2019 Apr 23. 10.1016/j.omtn.2019.04.015 PubMed 31108320