Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSWD95Y14D
(Plasmid #159098)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159098 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXCFPC-6
  • Backbone size w/o insert (bp) 4828
  • Total vector size (bp) 8389
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CckA 1-182, Linker SNVTRHRSATE, mClover3, CckA 183-691(Y514D), Linker SNVTRHRSAT, mRuby3
  • Alt name
    CckA FRET Sensor Y514D
  • Species
    Caulobacter crescentus
  • Insert Size (bp)
    3558
  • Mutation
    Mutated Y514 to D514
  • GenBank ID
    AF133718.1
  • Promoter Xylose

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCACATGTTAGCGCTACCAAGTGC
  • 3′ sequencing primer GCCAGGGTTTTCCCAGTCACGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector from Martin Thanbichler PM ID 17959646 "A comprehensive set of plasmids for vanillate- and xylose-inducible gene expression in Caulobacter crescentus".

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSWD95Y14D was a gift from Seth Childers (Addgene plasmid # 159098 ; http://n2t.net/addgene:159098 ; RRID:Addgene_159098)
  • For your References section:

    Design of a Histidine Kinase FRET Sensor to Detect Complex Signal Integration within Living Bacteria. Duvall SW, Childers WS. ACS Sens. 2020 Jun 26;5(6):1589-1596. doi: 10.1021/acssensors.0c00008. Epub 2020 Jun 16. 10.1021/acssensors.0c00008 PubMed 32495620