pSWD95D293A
              
              
                (Plasmid
                
                #159099)
              
            
            
            
          - 
            PurposeCckA FRET Sensor with DITE motif mutant
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepXCFPC-6
- Backbone size w/o insert (bp) 4828
- Total vector size (bp) 8389
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameCckA 1-182, Linker SNVTRHRSATE, mClover3, CckA 183-691 (D293A), Linker SNVTRHRSAT, mRuby3
- 
                  Alt nameCckA FRET Sensor
- 
                    SpeciesCaulobacter crescentus
- 
                  Insert Size (bp)3558
- 
                  MutationCckA D293 mutated to A293 and V199I on mRuby3 (Please see depositor comments)
- 
                    GenBank IDAF133718.1
- Promoter Xylose
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCACATGTTAGCGCTACCAAGTGC
- 3′ sequencing primer GCCAGGGTTTTCCCAGTCACGA (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector from Martin Thanbichler PM ID 17959646 "A comprehensive set of plasmids for vanillate- and xylose-inducible gene expression in Caulobacter crescentus".
Addgene NGS result had V199I on mRuby3. Depositor confirmed that this mutation does not affect the plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pSWD95D293A was a gift from Seth Childers (Addgene plasmid # 159099 ; http://n2t.net/addgene:159099 ; RRID:Addgene_159099)
- 
                For your References section: Design of a Histidine Kinase FRET Sensor to Detect Complex Signal Integration within Living Bacteria. Duvall SW, Childers WS. ACS Sens. 2020 Jun 26;5(6):1589-1596. doi: 10.1021/acssensors.0c00008. Epub 2020 Jun 16. 10.1021/acssensors.0c00008 PubMed 32495620
 
    
 
    
 
                         
             
            