pEXPqcxip-hCCDC47-FLAG
(Plasmid
#159141)
-
PurposeHu CCDC47 -flag mammalian expression Gateway vector.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159141 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemodified pQCXIP
-
Backbone manufacturerClontech / Takara Bio
- Backbone size w/o insert (bp) 7278
- Total vector size (bp) 8736
-
Modifications to backboneClontech's pQCXIP (7165 bp) vector was modified by insertion of a cassette into the BamHI site to create a Gateway Destination vector with a c-terminal FLAG tag. CCDC47 was inserted by a Gateway reaction, leaving 25bp recombination ATTB sequences on either side of CCDC47 sequence, followed by one FLAG epitope.
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecoiled-coil domain containing 47
-
Alt nameCCDC47; THNS; GK001; MSTP041
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1458
-
GenBank IDBC008905 NM_020198.3
-
Entrez GeneCCDC47 (a.k.a. GK001, MSTP041, THNS)
- Promoter CMV (cytomegalovirus) enhancer and the MSV (mouse sarcoma virus) promoter
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer acgccatccacgctgttttgacct
- 3′ sequencing primer gcggaattccggatcG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by'PlasmID Repository' of the Dana Farber /Harvard Cancer Center DNA Resource Core, now closed.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Bicistronic expression of CCDC47 and puromycin resistance.
Using the given reverse primer, the FLAG tag cannot be Sanger sequenced since they are only 17bp apart. More distant primers give poor sequence data because of the homomeric sequence of the IRES 3' of the insert.
This is the more distal reverse sequencing primer originally suggested by Clontech, which gives poor data: aagcggcttcggccagtaacgtta .
Alternate 5' CMV primers can be used, but they should first be checked against the vector's sequence to make sure that they do not occur more than one time.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEXPqcxip-hCCDC47-FLAG was a gift from Martin Dorf (Addgene plasmid # 159141 ; http://n2t.net/addgene:159141 ; RRID:Addgene_159141) -
For your References section:
Mapping a dynamic innate immunity protein interaction network regulating type I interferon production. Li S, Wang L, Berman M, Kong YY, Dorf ME. Immunity. 2011 Sep 23;35(3):426-40. Epub 2011 Sep 8. 10.1016/j.immuni.2011.06.014 PubMed 21903422