pET-28a RUVBL2 Delete
(Plasmid
#159143)
-
PurposeExpression and protien purification of a mutated RUVBL2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRUVBL2
-
SpeciesH. sapiens (human)
-
Mutationamino acid 2-456, Thr127-Glu233 mutated to GPPG
-
Entrez GeneRUVBL2 (a.k.a. CGI-46, ECP-51, ECP51, INO80J, REPTIN, RVB2, TAP54-beta, TIH2, TIP48, TIP49B)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sequencing was performed with T7, T7 terminal and R2 (GCTGGAGATGATCCGGGAAGGGA) primers.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-28a RUVBL2 Delete was a gift from Eric Erquan Zhang (Addgene plasmid # 159143 ; http://n2t.net/addgene:159143 ; RRID:Addgene_159143) -
For your References section:
Chemical perturbations reveal that RUVBL2 regulates the circadian phase in mammals. Ju D, Zhang W, Yan J, Zhao H, Li W, Wang J, Liao M, Xu Z, Wang Z, Zhou G, Mei L, Hou N, Ying S, Cai T, Chen S, Xie X, Lai L, Tang C, Park N, Takahashi JS, Huang N, Qi X, Zhang EE. Sci Transl Med. 2020 May 6;12(542). pii: 12/542/eaba0769. doi: 10.1126/scitranslmed.aba0769. 10.1126/scitranslmed.aba0769 PubMed 32376767