Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pET-28a RUVBL2 Full Length
(Plasmid #159142)


Item Catalog # Description Quantity Price (USD)
Plasmid 159142 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    RUVBL2 (a.k.a. CGI-46, ECP-51, ECP51, INO80J, REPTIN, RVB2, TAP54-beta, TIH2, TIP48, TIP49B)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Sequencing was performed with T7, T7 terminal and R2 (GCTGGAGATGATCCGGGAAGGGA) primers.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-28a RUVBL2 Full Length was a gift from Eric Erquan Zhang (Addgene plasmid # 159142 ; ; RRID:Addgene_159142)
  • For your References section:

    Chemical perturbations reveal that RUVBL2 regulates the circadian phase in mammals. Ju D, Zhang W, Yan J, Zhao H, Li W, Wang J, Liao M, Xu Z, Wang Z, Zhou G, Mei L, Hou N, Ying S, Cai T, Chen S, Xie X, Lai L, Tang C, Park N, Takahashi JS, Huang N, Qi X, Zhang EE. Sci Transl Med. 2020 May 6;12(542). pii: 12/542/eaba0769. doi: 10.1126/scitranslmed.aba0769. 10.1126/scitranslmed.aba0769 PubMed 32376767