NINJA TC
(Plasmid
#159274)
-
PurposeExpresses the NINJA targeting construct (inducible neoantigen expression via cumulative Cre, rtTA, doxycycline and tamoxifen).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZDonor
-
Backbone manufacturerMillipore Sigma
- Backbone size w/o insert (bp) 6417
- Total vector size (bp) 14921
-
Vector typeMammalian Expression, Mouse Targeting
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNINJA TC
-
Alt nameNINJA Targeting Construct
-
SpeciesH. sapiens (human), M. musculus (mouse), G. gallus (chicken), Synthetic; jellyfish, phage
-
Insert Size (bp)8504
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCTCTTCCCTCGTGATCTG
- 3′ sequencing primer GTCGAGGTGCCCGAAGGAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Puromycin resistance is deleted after Cre recombination.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NINJA TC was a gift from Nikhil Joshi (Addgene plasmid # 159274 ; http://n2t.net/addgene:159274 ; RRID:Addgene_159274) -
For your References section:
Inducible de novo expression of neoantigens in tumor cells and mice. Damo M, Fitzgerald B, Lu Y, Nader M, William I, Cheung JF, Connolly KA, Foster GG, Akama-Garren E, Lee DY, Chang GP, Gocheva V, Schmidt LM, Boileve A, Wilson JH, Cui C, Monroy I, Gokare P, Cabeceiras P, Jacks T, Joshi NS. Nat Biotechnol. 2020 Jul 27. pii: 10.1038/s41587-020-0613-1. doi: 10.1038/s41587-020-0613-1. 10.1038/s41587-020-0613-1 PubMed 32719479