CAGGS-AsCpf1-2A-GFP-U6-INS-sgRNA
(Plasmid #159283)

• Purpose: A multicistronic vector with CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA) targeting the human INS locus (sgINS).
• Depositing Lab: Rudolf Jaenisch
• Publication: Ma et al Cell Rep Med. 2020 Sep 22;1(6):100097. doi: 10.1016/j.xcrm.2020.100097. eCollection 2020 Sep 22.

Backbone

• Vector backbone: pCDNA3.1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Human INS sgRNA
• Species: H. sapiens (human)
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: gagggcctatttcccatgattcc

Gene/Insert 2

• Gene/Insert name: Human INS guide RNA
• Species: H. sapiens (human)

Resource Information

• Supplemental Documents:
  • CAGGS-AsCpf1-2A-GFP-U6-INS-sgRNA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry