AAVS1-PDL1
(Plasmid
#159280)
-
PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven human PDL1/CD274 (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC57
-
Vector typeMammalian Expression, AAV ; S1 knockin donor vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman PDL1/CD274
-
SpeciesH. sapiens (human)
-
Insert Size (bp)873
-
Entrez GeneCD274 (a.k.a. B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1)
- Promoter CAGGS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer ggcggctctagagcctctgctaacc
- 3′ sequencing primer ttggcagagggaaaaagatctcagtgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-PDL1 was a gift from Rudolf Jaenisch (Addgene plasmid # 159280 ; http://n2t.net/addgene:159280 ; RRID:Addgene_159280) -
For your References section:
Human T Cells Expressing a CD19 CAR-T Receptor Provide Insights into Mechanisms of Human CD19-Positive beta Cell Destruction. Ma H, Jeppesen JF, Jaenisch R. Cell Rep Med. 2020 Sep 22;1(6):100097. doi: 10.1016/j.xcrm.2020.100097. eCollection 2020 Sep 22. 10.1016/j.xcrm.2020.100097 PubMed 33205073