pJH23
(Plasmid
#159314)
-
PurposePunc-25 GFP::SYD-2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159314 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepSL1180
- Total vector size (bp) 11874
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesyd-2
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)5307
-
Entrez Genesyd-2 (a.k.a. CELE_F59F5.6)
- Promoter Punc-25
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gcggccgcgaaatatcgatt
- 3′ sequencing primer ggatccgCACAGCATCACTTTCGTCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH23 was a gift from Mei Zhen (Addgene plasmid # 159314 ; http://n2t.net/addgene:159314 ; RRID:Addgene_159314) -
For your References section:
Identification of genes involved in synaptogenesis using a fluorescent active zone marker in Caenorhabditis elegans. Yeh E, Kawano T, Weimer RM, Bessereau JL, Zhen M. J Neurosci. 2005 Apr 13;25(15):3833-41. doi: 10.1523/JNEUROSCI.4978-04.2005. 10.1523/JNEUROSCI.4978-04.2005 PubMed 15829635