MIGR1-CD5
(Plasmid #159329)

• Purpose: Over-expression of mouse CD5
• Depositing Lab: Nevil Singh
• Publication: Matson et al Proc Natl Acad Sci U S A. 2020 Jun 23;117(25):14342-14353. doi: 10.1073/pnas.1922525117. Epub 2020 Jun 8.

Backbone

• Vector backbone: MIGR1
• Vector type: Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD5
• Alt name: Lyt-1
• Alt name: Ly1
• Alt name: 12507
• Species: M. musculus (mouse)
• Insert Size (bp): 1485
• GenBank ID: NM_007650.3
• Entrez Gene: Cd5 (a.k.a. Ly-1, Ly-A, Ly-12, Lyt-1)
• Promoter: LTR

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GCATTCCTTTGGCGAGAG

Resource Information

• Supplemental Documents:
  • MIGR1-CD5
• A portion of this plasmid was derived from a plasmid made by: Derived from Addgene plasmid 27490 MIGR1 from Dr. Warren Pear's lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry