MIGR1-CD5
(Plasmid
#159329)
-
PurposeOver-expression of mouse CD5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159329 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMIGR1
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD5
-
Alt nameLyt-1
-
Alt nameLy1
-
Alt name12507
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1485
-
GenBank IDNM_007650.3
-
Entrez GeneCd5 (a.k.a. Ly-1, Ly-A, Ly-12, Lyt-1)
- Promoter LTR
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GCATTCCTTTGGCGAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDerived from Addgene plasmid 27490 MIGR1 from Dr. Warren Pear's lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MIGR1-CD5 was a gift from Nevil Singh (Addgene plasmid # 159329 ; http://n2t.net/addgene:159329 ; RRID:Addgene_159329) -
For your References section:
CD5 dynamically calibrates basal NF-kappaB signaling in T cells during thymic development and peripheral activation. Matson CA, Choi S, Livak F, Zhao B, Mitra A, Love PE, Singh NJ. Proc Natl Acad Sci U S A. 2020 Jun 23;117(25):14342-14353. doi: 10.1073/pnas.1922525117. Epub 2020 Jun 8. 10.1073/pnas.1922525117 PubMed 32513716