pDNA2.0-6H-TEV-KRAS G12D
(Plasmid
#159439)
-
PurposeExpresses KRAS G12D in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159439 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA2.0
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAS G12D
-
SpeciesH. sapiens (human)
-
Insert Size (bp)558
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter T5
-
Tag
/ Fusion Protein
- 6xHIS
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GATAAAACATATGCACCACCATCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDNA2.0-6H-TEV-KRAS G12D was a gift from Kenneth Westover (Addgene plasmid # 159439 ; http://n2t.net/addgene:159439 ; RRID:Addgene_159439) -
For your References section:
Tissue-Specific Oncogenic Activity of KRAS(A146T). Poulin EJ, Bera AK, Lu J, Lin YJ, Strasser SD, Paulo JA, Huang TQ, Morales C, Yan W, Cook J, Nowak JA, Brubaker DK, Joughin BA, Johnson CW, DeStefanis RA, Ghazi PC, Gondi S, Wales TE, Iacob RE, Bogdanova L, Gierut JJ, Li Y, Engen JR, Perez-Mancera PA, Braun BS, Gygi SP, Lauffenburger DA, Westover KD, Haigis KM. Cancer Discov. 2019 Jun;9(6):738-755. doi: 10.1158/2159-8290.CD-18-1220. Epub 2019 Apr 5. 10.1158/2159-8290.CD-18-1220 PubMed 30952657