pCL28-decoder
(Plasmid
#159450)
-
PurposeInsert: PlexAtet-lexA-ER-B112-tCyc1. The transcription factor LexA-ER-B112 (see addgene FRP880) is self-inducible upon addition of estradiol, and repressible by TetR. Backbone: pRG206MX. Marker: Ura3.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRG206MX
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 4302
- Total vector size (bp) 7109
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePlexAtet-LexA-ER-B112-tCyc1
-
SpeciesSynthetic
-
Insert Size (bp)2807
- Promoter PlexAtet
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer AATTAACCCTCACTAAAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypart of the insert from addGene FRP880_PACT1(-1-520)-LexA-ER-haB112-TCYC1. part of the promoter from addGene FRP793_insul-(lexA-box)4-PminCYC1-Citrine-TCYC1.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCL28-decoder was a gift from Joerg Stelling (Addgene plasmid # 159450 ; http://n2t.net/addgene:159450 ; RRID:Addgene_159450) -
For your References section:
A rationally engineered decoder of transient intracellular signals. Lormeau C, Rudolf F, Stelling J. Nat Commun. 2021 Mar 25;12(1):1886. doi: 10.1038/s41467-021-22190-4. 10.1038/s41467-021-22190-4 PubMed 33767179