Th-iCre
(Plasmid
#159459)
-
PurposeTargeting vector to TH gene locus for induction of P2A-fused iCre, with PGK-puroR drug resistant cassette flanked by FRT sequence.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePL652
- Backbone size w/o insert (bp) 6600
-
Vector typeMammalian Expression, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP2A-iCre
-
SpeciesSynthetic
-
Insert Size (bp)1122
- Promoter Endogenous TH
-
Tag
/ Fusion Protein
- P2A (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ctctcctccccaggagctat
- 3′ sequencing primer agcggtgctgtccatctgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Th-iCre was a gift from Yuejun Chen (Addgene plasmid # 159459 ; http://n2t.net/addgene:159459 ; RRID:Addgene_159459) -
For your References section:
Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Xiong M, Tao Y, Gao Q, Feng B, Yan W, Zhou Y, Kotsonis TA, Yuan T, You Z, Wu Z, Xi J, Haberman A, Graham J, Block J, Zhou W, Chen Y, Zhang SC. Cell Stem Cell. 2020 Sep 16. pii: S1934-5909(20)30410-0. doi: 10.1016/j.stem.2020.08.014. 10.1016/j.stem.2020.08.014 PubMed 32966778