Skip to main content

pAV-U6+27-Linear-1_PolyU(4) _HairpinDistance(0)_Tornado-Corn
(Plasmid #159496)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159496 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAV
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Termination Module:Linear-1_PolyU(4) _HairpinDistance(0)
  • Species
    Synthetic
  • Promoter U6-27

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer F_U6. MV.o87:GAAAGTAATAATTTCTTGGGTAGTTTG
  • 3′ sequencing primer MV.O12:gcaataaacaagttactagtcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAV-U6+27-Linear-1_PolyU(4) _HairpinDistance(0)_Tornado-Corn was a gift from Julius Lucks (Addgene plasmid # 159496 ; http://n2t.net/addgene:159496 ; RRID:Addgene_159496)
  • For your References section:

    RNA Sequence and Structure Determinants of Pol III Transcriptional Termination in Human Cells. Verosloff MS, Corcoran WK, Dolberg TB, Bushhouse DZ, Leonard JN, Lucks JB. J Mol Biol. 2021 Jun 25;433(13):166978. doi: 10.1016/j.jmb.2021.166978. Epub 2021 Apr 1. 10.1016/j.jmb.2021.166978 PubMed 33811918