lenti-25xAARE-minP-EGFP
(Plasmid
#159666)
-
PurposeEGFP reporter plasmid containing 25 tandem repeats of the amino acid response element (AARE)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159666 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCas9-Blast
-
Backbone manufacturerFeng Zhang
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name25xAARE-minP-EGFP
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer AATTCTGCAGACAAATGGCAGTA
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-25xAARE-minP-EGFP was a gift from Seiichi Oyadomari (Addgene plasmid # 159666 ; http://n2t.net/addgene:159666 ; RRID:Addgene_159666) -
For your References section:
Cell-based HTS identifies a chemical chaperone for preventing ER protein aggregation and proteotoxicity. Kitakaze K, Taniuchi S, Kawano E, Hamada Y, Miyake M, Oyadomari M, Kojima H, Kosako H, Kuribara T, Yoshida S, Hosoya T, Oyadomari S. Elife. 2019 Dec 17;8. pii: 43302. doi: 10.7554/eLife.43302. 10.7554/eLife.43302 PubMed 31843052