-
PurposeExpresses GFP-RPL10a for ribosomal immunoprecipitation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSicoR-eIF1a-mCherry
- Backbone size w/o insert (bp) 6909
- Total vector size (bp) 8295
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRPL10a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1386
-
GenBank IDNM_007104.5
-
Entrez GeneRPL10A (a.k.a. CSA19, Csa-19, L10A, NEDD6)
- Promoter eIF1a
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer ACCGGTGCCTAGAGAAGGTGG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSicoR-eIF1a-GFP-RPL10a was a gift from James Ellis (Addgene plasmid # 159890 ; http://n2t.net/addgene:159890 ; RRID:Addgene_159890) -
For your References section:
Shifts in Ribosome Engagement Impact Key Gene Sets in Neurodevelopment and Ubiquitination in Rett Syndrome. Rodrigues DC, Mufteev M, Weatheritt RJ, Djuric U, Ha KCH, Ross PJ, Wei W, Piekna A, Sartori MA, Byres L, Mok RSF, Zaslavsky K, Pasceri P, Diamandis P, Morris Q, Blencowe BJ, Ellis J. Cell Rep. 2020 Mar 24;30(12):4179-4196.e11. doi: 10.1016/j.celrep.2020.02.107. 10.1016/j.celrep.2020.02.107 PubMed 32209477