Skip to main content

pSicoR-eIF1a-GFP-RPL10a
(Plasmid #159890)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159890 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSicoR-eIF1a-mCherry
  • Backbone size w/o insert (bp) 6909
  • Total vector size (bp) 8295
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RPL10a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1386
  • GenBank ID
    NM_007104.5
  • Entrez Gene
    RPL10A (a.k.a. CSA19, Csa-19, L10A, NEDD6)
  • Promoter eIF1a
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer ACCGGTGCCTAGAGAAGGTGG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSicoR-eIF1a-GFP-RPL10a was a gift from James Ellis (Addgene plasmid # 159890 ; http://n2t.net/addgene:159890 ; RRID:Addgene_159890)
  • For your References section:

    Shifts in Ribosome Engagement Impact Key Gene Sets in Neurodevelopment and Ubiquitination in Rett Syndrome. Rodrigues DC, Mufteev M, Weatheritt RJ, Djuric U, Ha KCH, Ross PJ, Wei W, Piekna A, Sartori MA, Byres L, Mok RSF, Zaslavsky K, Pasceri P, Diamandis P, Morris Q, Blencowe BJ, Ellis J. Cell Rep. 2020 Mar 24;30(12):4179-4196.e11. doi: 10.1016/j.celrep.2020.02.107. 10.1016/j.celrep.2020.02.107 PubMed 32209477