Skip to main content

pAAV-CMV-FLEX-SaCas9-U6-sgRosa26
(Plasmid #159914)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159914 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-FLEX-SaCas9-U6-sgRNA
  • Backbone manufacturer
    Larry Zweifel (Addgene plasmid # 124844)
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rosa26 gRNA
  • gRNA/shRNA sequence
    ctcgatggaaaatactccgag
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Gt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-FLEX-SaCas9-U6-sgRosa26 was a gift from Larry Zweifel (Addgene plasmid # 159914 ; http://n2t.net/addgene:159914 ; RRID:Addgene_159914)