K20‐scFv‐pSMBP2
(Plasmid
#159940)
-
PurposeTo generate baculovirus for insect cell expression of anti beta-1 integrin scFv K20
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSMBP2
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 6754
-
Modifications to backboneInserted two Sbf restriction sites flanking the MBP sequence for genetic removal of MBP.
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti beta-1 integrin scFv
-
Alt namesingle chain variable fragment
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1956
- Promoter Polyhedrin
-
Tags
/ Fusion Proteins
- 6xHis tag (N terminal on insert)
- MBP fusion (N terminal on insert)
- TEV site (N terminal on insert)
- FLAG tag (C terminal on insert)
- Sortase A recognition site (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer pFASTBAC For (GGATTATTCATACCGTCCCA)
- 3′ sequencing primer pFASTBAC Rev (CAAATGTGGTATGGCTGATT)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K20‐scFv‐pSMBP2 was a gift from Sandra Schmid (Addgene plasmid # 159940 ; http://n2t.net/addgene:159940 ; RRID:Addgene_159940) -
For your References section:
A functionally neutral single chain antibody to measure beta-1 integrin uptake and recycling. Lakoduk AM, Kadlecova Z, Schmid SL. Traffic. 2020 Sep;21(9):590-602. doi: 10.1111/tra.12754. Epub 2020 Jul 21. 10.1111/tra.12754 PubMed 32613646