NDV-HN-SpyTag
(Plasmid
#160000)
-
PurposeExpresses Newcastle disease virus HN protein (47-575) with C-terminal SpyTag fusion in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHL-sec
-
Backbone manufacturerEdith Yvonne Jones, University of Oxford
- Backbone size w/o insert (bp) 4632
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNDV-HN-SpyTag
-
SpeciesNewcastle disease virus
-
Insert Size (bp)1794
- Promoter Chicken beta-actin promoter
-
Tag
/ Fusion Protein
- His6-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCCTACAGCTCCTGGGCAAC
- 3′ sequencing primer CACCAGCCACCACCTTCTGATAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NDV-HN-SpyTag was a gift from Mark Howarth (Addgene plasmid # 160000 ; http://n2t.net/addgene:160000 ; RRID:Addgene_160000) -
For your References section:
Overcoming Symmetry Mismatch in Vaccine Nanoassembly through Spontaneous Amidation. Rahikainen R, Rijal P, Tan TK, Wu HJ, Andersson AC, Barrett JR, Bowden TA, Draper SJ, Townsend AR, Howarth M. Angew Chem Int Ed Engl. 2020 Sep 4. doi: 10.1002/anie.202009663. 10.1002/anie.202009663 PubMed 32886840