Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

NDV-HN-SpyTag
(Plasmid #160000)

Ordering

This material is available to academics and nonprofits only. Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 160000 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHL-sec
  • Backbone manufacturer
    Edith Yvonne Jones, University of Oxford
  • Backbone size w/o insert (bp) 4632
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NDV-HN-SpyTag
  • Species
    Newcastle disease virus
  • Insert Size (bp)
    1794
  • Promoter Chicken beta-actin promoter
  • Tag / Fusion Protein
    • His6-tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCCTACAGCTCCTGGGCAAC
  • 3′ sequencing primer CACCAGCCACCACCTTCTGATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NDV-HN-SpyTag was a gift from Mark Howarth (Addgene plasmid # 160000 ; http://n2t.net/addgene:160000 ; RRID:Addgene_160000)
  • For your References section:

    Overcoming Symmetry Mismatch in Vaccine Nanoassembly through Spontaneous Amidation. Rahikainen R, Rijal P, Tan TK, Wu HJ, Andersson AC, Barrett JR, Bowden TA, Draper SJ, Townsend AR, Howarth M. Angew Chem Int Ed Engl. 2020 Sep 4. doi: 10.1002/anie.202009663. 10.1002/anie.202009663 PubMed 32886840