NbBCP1b-p3
(Plasmid
#160002)
-
PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the NbBCP1b promoter for visualisation of arbuscular mycorrhizal colonisation in Nicotiana benthamiana roots
-
Depositing Lab
-
Depositing OrganizationUniversity of Cambridge
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160002 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepICSL4723
-
Backbone manufacturer86173 (Mark Youles)
- Backbone size w/o insert (bp) 4901
- Total vector size (bp) 14129
-
Vector typePlant Expression
-
Selectable markersBar
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameBar (reverse orientation)
-
Alt namePhosphinotricin N-acetyltransferase
-
Alt nameBialaphos resistance
-
Insert Size (bp)552
-
GenBank ID
- Promoter Agrobacterium tumefaciens Nopaline synthase Promoter (AtuNos Pro)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer Bar_F: ATGTCTCCTGAAAGAAGGCC
- 3′ sequencing primer Bar_R: TCAAATCTCAGTCACAGGAAGA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDODAα1
-
Alt name4,5-DOPA dioxygenase alpha 1
-
SpeciesBeta vulgaris
-
Insert Size (bp)828
-
GenBank IDMH836616
- Promoter Nicotiana benthamiana Blue Copper Protein 1b (NbBCP1b Pro)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer BvDODAα1_F: ATGAAAATGATGAATGGAGAAG
- 3′ sequencing primer BvDODAα1_R: CTAGGCTGAAGTGAACTTGTAG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCYP76AD1
-
Alt namecytochrome P450 76AD1
-
SpeciesBeta vulgaris
-
Insert Size (bp)1494
-
GenBank IDMH836617
- Promoter Nicotiana benthamiana Blue Copper Protein 1b (NbBCP1b Pro)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer BvCYP76AD1_F: ATGGATCATGCAACATTAGCA
- 3′ sequencing primer BvCYP76AD1_R: TCAATACCTAGGTATTGGAATAAGTTTTAA
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namecDOPA5GT
-
Alt namecyclo-DOPA 5-O-glucosyltransferase
-
SpeciesMirabilis jalapa
-
Insert Size (bp)1503
-
GenBank IDMH836618
- Promoter Nicotiana benthamiana Blue Copper Protein 1b (NbBCP1b Pro)
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer MjcDOPA5GT_F: ATGACCGCCATTAAAATG
- 3′ sequencing primer MjcDOPA5GT_R: TTATTGAAGAGAAGGTTCCAAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NbBCP1b-p3 was a gift from Sam Brockington (Addgene plasmid # 160002 ; http://n2t.net/addgene:160002 ; RRID:Addgene_160002) -
For your References section:
MycoRed: Betalain pigments enable in vivo real-time visualisation of arbuscular mycorrhizal colonisation. Timoneda A, Yunusov T, Quan C, Gavrin A, Brockington SF, Schornack S. PLoS Biol. 2021 Jul 14;19(7):e3001326. doi: 10.1371/journal.pbio.3001326. 10.1371/journal.pbio.3001326 PubMed 34260583