Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

NbBCP1b-p3
(Plasmid #160002)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160002 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pICSL4723
  • Backbone manufacturer
    86173 (Mark Youles)
  • Backbone size w/o insert (bp) 4901
  • Total vector size (bp) 14129
  • Vector type
    Plant Expression
  • Selectable markers
    Bar

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Bar (reverse orientation)
  • Alt name
    Phosphinotricin N-acetyltransferase
  • Alt name
    Bialaphos resistance
  • Insert Size (bp)
    552
  • GenBank ID
  • Promoter Agrobacterium tumefaciens Nopaline synthase Promoter (AtuNos Pro)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer Bar_F: ATGTCTCCTGAAAGAAGGCC
  • 3′ sequencing primer Bar_R: TCAAATCTCAGTCACAGGAAGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    DODAα1
  • Alt name
    4,5-DOPA dioxygenase alpha 1
  • Species
    Beta vulgaris
  • Insert Size (bp)
    828
  • GenBank ID
    MH836616
  • Promoter Nicotiana benthamiana Blue Copper Protein 1b (NbBCP1b Pro)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer BvDODAα1_F: ATGAAAATGATGAATGGAGAAG
  • 3′ sequencing primer BvDODAα1_R: CTAGGCTGAAGTGAACTTGTAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    CYP76AD1
  • Alt name
    cytochrome P450 76AD1
  • Species
    Beta vulgaris
  • Insert Size (bp)
    1494
  • GenBank ID
    MH836617
  • Promoter Nicotiana benthamiana Blue Copper Protein 1b (NbBCP1b Pro)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer BvCYP76AD1_F: ATGGATCATGCAACATTAGCA
  • 3′ sequencing primer BvCYP76AD1_R: TCAATACCTAGGTATTGGAATAAGTTTTAA
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    cDOPA5GT
  • Alt name
    cyclo-DOPA 5-O-glucosyltransferase
  • Species
    Mirabilis jalapa
  • Insert Size (bp)
    1503
  • GenBank ID
    MH836618
  • Promoter Nicotiana benthamiana Blue Copper Protein 1b (NbBCP1b Pro)

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer MjcDOPA5GT_F: ATGACCGCCATTAAAATG
  • 3′ sequencing primer MjcDOPA5GT_R: TTATTGAAGAGAAGGTTCCAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NbBCP1b-p3 was a gift from Sam Brockington (Addgene plasmid # 160002 ; http://n2t.net/addgene:160002 ; RRID:Addgene_160002)
  • For your References section:

    MycoRed: Betalain pigments enable in vivo real-time visualisation of arbuscular mycorrhizal colonisation. Timoneda A, Yunusov T, Quan C, Gavrin A, Brockington SF, Schornack S. PLoS Biol. 2021 Jul 14;19(7):e3001326. doi: 10.1371/journal.pbio.3001326. 10.1371/journal.pbio.3001326 PubMed 34260583